Stem-loop sequence cgr-let-7g

AccessionMI0020373 (change log)
DescriptionCricetulus griseus let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ---a    a   u        a            ugagg    -a  a    a 
5'     uucc ggc gagguagu guuuguacaguu     gucu  ug uacc c
       |||| ||| |||||||| ||||||||||||     ||||  || ||||  
3'     aagg ccg uuccguca cggacaugucaa     uaga  ac augg c
   cgac    a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
12002522 reads, 1.66e+05 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000078.1: 2992041-2992137 [+]
intergenic
Database links

Mature sequence cgr-let-7g-5p

Accession MIMAT0023722
Sequence

10 - 

ugagguaguaguuuguacaguu

 - 31

Get sequence
Deep sequencing11981321 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-let-7g-3p

Accession MIMAT0023723
Sequence

67 - 

cuguacaggccacugccuugc

 - 87

Get sequence
Deep sequencing108 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).