Stem-loop sequence cgr-mir-24

AccessionMI0020468 (change log)
DescriptionCricetulus griseus miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

2 open access papers mention cgr-mir-24
(2 sentences)

Stem-loop
   --uccgc       g   a         aa    ug  u 
5'        cuccugu ccu cugagcuga  cagu  au c
          ||||||| ||| |||||||||  ||||  ||  
3'        gaggaca gga gacuugacu  guca  ug c
   ccgaccu       a   c         cg    cg  a 
Get sequence
Deep sequencing
1089556 reads, 1.41e+04 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000286.1: 1078704-1078781 [-]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-24
cgr-mir-23aJH000286.1: 1079003-1079078 [-]
cgr-mir-27aJH000286.1: 1078836-1078916 [-]
cgr-mir-24JH000286.1: 1078704-1078781 [-]
cgr-mir-3074-2JH000286.1: 1078703-1078785 [+]
Database links

Mature sequence cgr-miR-24-5p

Accession MIMAT0023866
Sequence

11 - 

gugccuacugagcugaaacag

 - 31

Get sequence
Deep sequencing29701 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cgr-miR-24-3p

Accession MIMAT0023867
Sequence

47 - 

uggcucaguucagcaggaacagg

 - 69

Get sequence
Deep sequencing1041006 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).