Stem-loop sequence ggo-let-7g

AccessionMI0020623 (change log)
DescriptionGorilla gorilla let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ccuuuu  -   a    a   u        a            ugagg    -a  a    a 
5'       gc cug uucc ggc gagguagu guuuguacaguu     gucu  ug uacc c
         || ||| |||| ||| |||||||| ||||||||||||     ||||  || ||||  
3'       cg gac aagg ccg uuccguca cggacaugucaa     uaga  ac augg c
   -----g  c   -    a   -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr3: 53291713-53291823 [-]
sense
ENSGGOT00000015887 ; TLR9-203; intron 2
Database links

Mature sequence ggo-let-7g

Accession MIMAT0024076
Sequence

21 - 

ugagguaguaguuuguacagu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).