Stem-loop sequence cca-MIR160a

AccessionMI0021067 (change log)
DescriptionCynara cardunculus miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention cca-MIR160a
(3 sentences)

Stem-loop
   --   a             - u  a      c      -aa     u  a 
5'   aug uuugccuggcucc c gg ugccau uaagaa   ugauu ca g
     ||| ||||||||||||| | || |||||| ||||||   ||||| ||  
3'   uac aaacggacugagg g cc acggua auucuu   acuaa gu g
   aa   -             a u  -      u      cug     c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR160a

Accession MIMAT0024513
Sequence

7 - 

ugccuggcucccuggaugcca

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).