Stem-loop sequence gga-mir-6545

AccessionMI0022361 (change log)
DescriptionGallus gallus miR-6545 stem-loop
Stem-loop
   --a  uuu    ----    -ca    g       -g    g       -a   gaa 
5'    gg   cucu    uguu   auug cagaaaa  ggcu cagcuuc  ucu   g
      ||   ||||    ||||   |||| |||||||  |||| |||||||  |||    
3'    cc   gaga    acga   uaac gucuuuu  ucga gucgaag  agg   u
   cgg  uac    cagu    cag    g       ag    g       ag   uca 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 71893322-71893428 [+]
intergenic
AADN04002826.1: 3926-4032 [-]
intergenic
Database links

Mature sequence gga-miR-6545-5p

Accession MIMAT0025593
Sequence

20 - 

ggcagaaaagggcugcagcuu

 - 40

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6545-3p

Accession MIMAT0025594
Sequence

61 - 

agcuggagcugauuuucuggca

 - 82

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).