Stem-loop sequence gga-mir-6554

AccessionMI0022372 (change log)
DescriptionGallus gallus miR-6554 stem-loop
Stem-loop
   ----------ua    -uu    cuu            c           --uaug  c 
5'             gcug   aauc   ugaguguuuuua auuacacagca      uc a
               ||||   ||||   |||||||||||| |||||||||||      ||  
3'             cgac   uuag   acucauaggaau uggugugucgu      ag g
   gacaaacgucaa    cuc    -uc            u           cuugaa  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 6787494-6787599 [+]
intergenic
Database links

Mature sequence gga-miR-6554-5p

Accession MIMAT0025615
Sequence

20 - 

uguuuuuacauuacacagcaua

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6554-3p

Accession MIMAT0025616
Sequence

58 - 

ugcugugugguuuaaggauacu

 - 79

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).