Stem-loop sequence gga-mir-6580

AccessionMI0022399 (change log)
DescriptionGallus gallus miR-6580 stem-loop
Stem-loop
   agacuuuuuc   -uuu   a  c   ga    a        c  -    gaaa 
5'           ugc    guu ca aga  auug cuucagug ug acug    a
             |||    ||| || |||  |||| |||||||| || ||||    u
3'           acg    caa gu ucu  uaac gagguuau ac ugac    c
   ---cccagaa   uuau   c  a   ag    g        -  g    aaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 27382792-27382896 [-]
sense
ENSGALT00000016296 ; PLB1-201; exon 37
Database links

Mature sequence gga-miR-6580-5p

Accession MIMAT0025667
Sequence

26 - 

agaauugacuucagugcugacu

 - 47

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6580-3p

Accession MIMAT0025668
Sequence

62 - 

gugcauauuggaggcaaugaucu

 - 84

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).