Stem-loop sequence gga-mir-6585

AccessionMI0022405 (change log)
DescriptionGallus gallus miR-6585 stem-loop
Stem-loop
   uacugaaaaugaagacag       a       -----       a   -----u   -u      u 
5'                   gaaucag acgugcu     gugagcu cuu      gca  gugagc a
                     ||||||| |||||||     ||||||| |||      |||  |||||| c
3'                   cuugguu ugcacga     uauucga gag      cgu  uauuug c
   ----------------ua       a       gguuu       g   ugaugu   uu      u 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 5039446-5039555 [+]
intergenic
Database links

Mature sequence gga-miR-6585-5p

Accession MIMAT0025676
Sequence

20 - 

aaucagaacgugcugugagcu

 - 40

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).