Stem-loop sequence gga-mir-6620

AccessionMI0022439 (change log)
DescriptionGallus gallus miR-6620 stem-loop
Stem-loop
   ----------gca  g   cc      gcaga     aa c  u           g   caaag 
5'              gc cag  gacccc     gaugg  g gc gcgcacggugc uag     a
                || |||  ||||||     |||||  | || ||||||||||| |||      
3'              cg guc  cugggg     cugcc  c cg cgugugccaug guc     g
   ccccuacccuacc  a   -c      -----     -- -  -           g   uaggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr25: 2809804-2809913 [+]
sense
ENSGALT00000001354 ; CGN-201; 3'UTR (exon 10)
Database links

Mature sequence gga-miR-6620-5p

Accession MIMAT0025716
Sequence

20 - 

agagauggaagcgcugcgcacgg

 - 42

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).