Stem-loop sequence gga-mir-6642

AccessionMI0022461 (change log)
DescriptionGallus gallus miR-6642 stem-loop
Stem-loop
   ------------acacgac      g    g              agcggg      c 
5'                    gccgcc ccgc uuccccgacggccg      ccgcuc g
                      |||||| |||| ||||||||||||||      ||||||  
3'                    uggcgg ggcg aaggggcugccggc      ggcggg c
   uccgccuccuuaucggcga      a    a              -----g      g 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6642-5p

Accession MIMAT0025739
Sequence

20 - 

uuccccgacggccgagcgggcc

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6642-3p

Accession MIMAT0025740
Sequence

53 - 

cgggcggccgucggggaaagcgg

 - 75

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).