Stem-loop sequence gga-mir-6706

AccessionMI0022528 (change log)
DescriptionGallus gallus miR-6706 stem-loop
Stem-loop
   ---cuuucac       g    ----   ag  ----      au    u    u   uu 
5'           uggaaca ggca    gcu  ga    ggagaa  ggag gggc gag  u
             ||||||| ||||    |||  ||    ||||||  |||| |||| |||   
3'           acuuugu cugu    cga  cu    ccucuu  ucuc ucug cuc  u
   acaacgucgu       a    gaaa   ca  auga      cg    -    u   uc 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 23667294-23667403 [-]
sense
ENSGALT00000038374 ; DGKZ-201; exon 8
Database links

Mature sequence gga-miR-6706-5p

Accession MIMAT0025816
Sequence

26 - 

aggagaaauggagugggcugag

 - 47

Get sequence
Deep sequencing37 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).