Stem-loop sequence hsa-mir-6893

Accession

MI0022740 (change log)

Symbol

HGNC:MIR6893

Description

Homo sapiens miR-6893 stem-loop

Literature search

1 open access papers mention hsa-mir-6893
(1 sentences)

Stem-loop

   ccg      --c    -       -------      ca 
5'    ggcagg   aggu guagggu       ggagcc  c
      ||||||   |||| |||||||       ||||||   
3'    ccgucc   uccg cgucccg       ccucgg  u
   -ga      acu    u       acucagu      ug 

Deep sequencing

43 reads, 0 reads per million, 28 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 144435551-144435619 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000381248 ; TOP1MT-002; intron 1

  OTTHUMT00000381331 ; TOP1MT-020; intron 1

  OTTHUMT00000381294 ; TOP1MT-003; intron 2

  OTTHUMT00000381327 ; TOP1MT-011; intron 2

  OTTHUMT00000381300 ; TOP1MT-004; intron 2

  OTTHUMT00000381330 ; TOP1MT-010; intron 3

  ENST00000519148 ; TOP1MT-002; intron 1

  ENST00000518760 ; TOP1MT-020; intron 1

  ENST00000521193 ; TOP1MT-003; intron 2

  ENST00000520950 ; TOP1MT-011; intron 2

  ENST00000505857 ; TOP1MT-004; intron 2

  ENST00000521024 ; TOP1MT-010; intron 3

Database links

• HGNC:MIR6893
• miRBase Tracker:MI0022740

Mature sequence hsa-miR-6893-5p

• Accession: MIMAT0027686
• Sequence: 6 - caggcagguguaggguggagc - 26
• Deep sequencing: 17 reads, 11 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6893-5p
  • miRDB:hsa-miR-6893-5p

Mature sequence hsa-miR-6893-3p

• Accession: MIMAT0027687
• Sequence: 48 - cccugcugccuucaccugccag - 69
• Deep sequencing: 9 reads, 7 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6893-3p
  • miRDB:hsa-miR-6893-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).