Stem-loop sequence ccr-let-7g

AccessionMI0023299 (change log)
DescriptionCyprinus carpio let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention ccr-let-7g
(31 sentences)

Stem-loop
   ----u      u   gu     u          ----uua     ac 
5'      guggga gag  aguag uuguauaguu       ggauc  a
        |||||| |||  ||||| ||||||||||       |||||   
3'      cacccu uuc  ucauc gacauaucaa       ucuag  c
   aaugg      -   ug     u          uagaggg     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-let-7g

Accession MIMAT0026191
Sequence

8 - 

ugagguaguaguuuguauaguu

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).