|
miRBase |
|
Stem-loop sequence bma-mir-5857 |
|
| Accession | MI0023456 |
| Description | Brugia malayi miR-5857 stem-loop |
| Stem-loop |
acuu uu - uu uu g u uu g ag gaaguuu uggga u c gaggagga c | || ||||||| ||||| | | |||||||| g c uc cuucaag acccu a g cuccucuu a guug uc u cc -u g c ca |
| Comments |
This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1]. |
Mature sequence bma-miR-5857 |
|
| Accession | MIMAT0026356 |
| Sequence |
11 - aaguuuuuugggauuugcugagga - 34 |
| Evidence | not experimental |
References |
|
| 1 |
PMID:22216965
"Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel"
BMC Genomics. 13:4(2012).
|