Stem-loop sequence gga-mir-1467-2

AccessionMI0023550 (change log)
DescriptionGallus gallus miR-1467-2 stem-loop
Gene family MIPF0001416; mir-1467
Literature search

1 open access papers mention gga-mir-1467-2
(1 sentences)

Stem-loop
   ----g    --a  ---a      g uu      c   a  -     a    -   ggca 
5'      ggac   gg    cagguu u  ucucag uac uc ggugu aauc cag    a
        ||||   ||    |||||| |  |||||| ||| || ||||| |||| |||     
3'      ccug   cc    gucuaa a  aggguc aug ag ccaca uugg guc    u
   gucca    cua  accg      g cu      a   -  a     c    a   aucu 
Get sequence
Deep sequencing
112 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-1467-5p

Accession MIMAT0007345
Previous IDsgga-miR-1467
Sequence

20 - 

ucucagcuacaucgguguaaauc

 - 42

Get sequence
Deep sequencing26 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1467-3p

Accession MIMAT0007346
Previous IDsgga-miR-1467*
Sequence

63 - 

ucacaccagaguaacugggauc

 - 84

Get sequence
Deep sequencing198 reads, 4 experiments
Evidence experimental; 454 [1], Northern [1], Illumina [2]
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).