Stem-loop sequence dre-mir-7147

AccessionMI0023606 (change log)
DescriptionDanio rerio miR-7147 stem-loop
Gene family MIPF0001705; mir-7147
Literature search

2 open access papers mention dre-mir-7147
(3 sentences)

Stem-loop
       gc      cu    c        a       u aaa 
5' gagu  ccagug  guac augcuggu gccagua g   u
   ||||  ||||||  |||| |||||||| ||||||| |    
3' cucg  ggucac  cgug ugcgacca uggucgu c   a
       uu      cc    u        a       u ggg 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 10948064-10948145 [-]
sense
OTTDART00000044394 ; asap1b-001; intron 10
ENSDART00000145466 ; asap1b-001; intron 10
ENSDART00000030409 ; asap1b-201; intron 10
Database links

Mature sequence dre-miR-7147

Accession MIMAT0028205
Sequence

14 - 

uguaccaugcugguagccagu

 - 34

Get sequence
Deep sequencing110 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).