Stem-loop sequence pmi-let-7

AccessionMI0025085 (change log)
DescriptionPatiria miniata let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention pmi-let-7
(4 sentences)

Stem-loop
   cuacaa   uuc     g  ug    -   c       a     agaaaua a  u 
5'       gcg   ccuuu ug  aggu agu gguugua agaua       c cc g
         |||   ||||| ||  |||| ||| ||||||| |||||       | ||  
3'       cgu   ggaaa ac  uuca uca ccaacau ucuau       g gg a
   ---aca   uuu     -  cu    a   c       a     ------a c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-let-7-5p

Accession MIMAT0032139
Sequence

21 - 

ugagguagucgguuguaaaga

 - 41

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).