Stem-loop sequence pmi-mir-31-3

AccessionMI0025095 (change log)
DescriptionPatiria miniata miR-31-3 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   ---   --g   a     g    u          uuu  uu 
5'    gug   aga ggcaa augu ggcauagcug   ga  c
      |||   ||| ||||| |||| ||||||||||   ||  a
3'    cac   uuu ccguu uaca ucgugucgac   cu  a
   guu   gua   a     a    c          --u  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-31-5p

Accession MIMAT0032147
Sequence

8 - 

aggcaagauguuggcauagcu

 - 28

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).