Stem-loop sequence mtr-MIR169i

AccessionMI0025203 (change log)
DescriptionMedicago truncatula miR169i stem-loop
Literature search

12 open access papers mention mtr-MIR169i
(59 sentences)

Stem-loop
      u        a  ug   u       -u  --u    gaaaa 
5' gau ugagccaa ga  acu gccggca  gc   gccu     g
   ||| |||||||| ||  ||| |||||||  ||   ||||      
3' uug acuugguu cu  uga cggucgu  ug   uggg     c
      u        a  gu   -       uu  uug    aagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR169i

Accession MIMAT0029963
Sequence

5 - 

ugagccaaagaugacuugccgg

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).