Stem-loop sequence mtr-MIR399t

AccessionMI0025232 (change log)
DescriptionMedicago truncatula miR399t stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399t
(22 sentences)

Stem-loop
   --     uu    ua a   ug   u    a         a  uagu     ---u     a     
5'   ugcag  gaau  c ggg  agu cucc uuggcaggu gc    cacua    augau ugca 
     |||||  ||||  | |||  ||| |||| ||||||||| ||    |||||    ||||| ||| u
3'   acguc  cuua  g ccc  uua gagg aaccgucua cg    gugau    uacua acgu 
   ca     cu    gc a   gu   -    a         a  ---u     ucuu     -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24156521-24156643 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399t
mtr-MIR399gchr8: 23158805-23158908 [-]
mtr-MIR399fchr8: 23166508-23166611 [-]
mtr-MIR399fchr8: 23986801-23986904 [+]
mtr-MIR399gchr8: 23994507-23994610 [+]
mtr-MIR399fchr8: 24153821-24153924 [+]
mtr-MIR399tchr8: 24156521-24156643 [+]
mtr-MIR399gchr8: 24161515-24161618 [+]
mtr-MIR399fchr8: 24222878-24222981 [+]
mtr-MIR399gchr8: 24230599-24230702 [+]
Database links

Mature sequence mtr-miR399t-5p

Accession MIMAT0030005
Sequence

16 - 

gggugaguucuccauuggcaggu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR399t-3p

Accession MIMAT0030006
Sequence

88 - 

ugccaaaggagauuugcccag

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).