Stem-loop sequence oar-mir-221

AccessionMI0025269 (change log)
DescriptionOvis aries miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

3 open access papers mention oar-mir-221
(6 sentences)

Stem-loop
   -----ccaaca       cuag   a    -  ug   u         auuu    -      
5'            uccaggu    ggc ugaa cc  gca acaauguag    cugu guuug 
              |||||||    ||| |||| ||  ||| |||||||||    |||| |||| u
3'            aggucca    ucg acuu gg  cgu uguuacauc    gaca cgagu 
   uucuugcacaa       ----   g    u  gu   c         ----    a      
Get sequence
Deep sequencing
16456 reads, 3.18e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chrX: 42566420-42566529 [-]
intergenic
Database links

Mature sequence oar-miR-221

Accession MIMAT0030047
Sequence

65 - 

agcuacauugucugcuggguuu

 - 86

Get sequence
Deep sequencing16319 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).