Stem-loop sequence bdi-MIR159b

AccessionMI0025295 (change log)
DescriptionBrachypodium distachyon miR159b stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   ---u    uu  g ug        a   u     ugaaa    u  c  aa     -  a a   g    u     guuc    uuau         auua 
5'     gguu  ga g  gagcuccu uca uccaa     gguc gu ag  gggug au c gcu cuug ucaug    ccac    ccuaucucc    g
       ||||  || |  |||||||| ||| |||||     |||| || ||  ||||| || | ||| |||| |||||    ||||    |||||||||    a
3'     cuag  cu c  cucgaggg agu agguu     ccag cg uc  cccac ua g cga gagc aguac    ggug    ggauggagg    a
   cuuu    uu  a gu        a   u     ugucg    c  u  --     c  c c   g    c     guuu    -uuc         agga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 1091342-1091539 [+]
intergenic
Database links

Mature sequence bdi-miR159b-5p.1

Accession MIMAT0030081
Sequence

14 - 

gagcuccuaucauuccaauga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR159b-5p.2

Accession MIMAT0030082
Sequence

35 - 

aaggucugucagaagggugauac

 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR159b-5p.3

Accession MIMAT0030083
Sequence

58 - 

agcugcuuguucaugguuccc

 - 78

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR159b-3p.3

Accession MIMAT0030084
Sequence

121 - 

uuugcaugaccgaggagccgc

 - 141

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR159b-3p.2

Accession MIMAT0030085
Sequence

142 - 

auccaccccuugccgaccgcug

 - 163

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR159b-3p.1

Accession MIMAT0030086
Sequence

164 - 

uuuggauugaagggagcucug

 - 184

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).