Stem-loop sequence bdi-MIR7724b

AccessionMI0025338 (change log)
DescriptionBrachypodium distachyon miR7724b stem-loop
Gene family MIPF0001802; MIR7724
Stem-loop
   uuu    g  a          ac   cu           c   acga      ----               a  ----ug  uu  caa 
5'    ggca ag gugaacaugu  aug  ggccaacccaa ccc    uccacc    aucggcaugagcaug ug      ug  cu   a
      |||| || ||||||||||  |||  ||||||||||| |||    ||||||    ||||||||||||||| ||      ||  ||    
3'    ucgu uc cacuuguaca  uac  ccgguuggguu ggg    aggugg    uggucgugcucguac ac      ac  ga   u
   ugu    g  c          gu   ac           c   ----      gaaa               c  uaaaug  cg  cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 56080928-56081097 [-]
intergenic
Database links

Mature sequence bdi-miR7724b-5p

Accession MIMAT0030176
Sequence

13 - 

ugaacauguacaugcuggccaacc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7724b-3p

Accession MIMAT0030177
Sequence

137 - 

uuggcccacauugacauguucacc

 - 160

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).