Stem-loop sequence bdi-MIR7727

AccessionMI0025342 (change log)
DescriptionBrachypodium distachyon miR7727 stem-loop
Stem-loop
   -----ug  c      g               uc       ag ug   ag 
5'        gg gaagcu auuaguuucaguugg  ugggcga  u  auu  u
          || |||||| |||||||||||||||  |||||||  |  |||   
3'        cc cuucga uaaucaagguuagcu  accugcu  g  uga  u
   aucaaaa  -      g               ga       gu gu   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 13610099-13610196 [+]
intergenic
Database links

Mature sequence bdi-miR7727-5p

Accession MIMAT0030186
Sequence

11 - 

ugauuaguuucaguuggucugggc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7727-3p

Accession MIMAT0030187
Sequence

63 - 

ccaagucgauuggaacuaaugagc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).