Stem-loop sequence bdi-MIR7730

AccessionMI0025346 (change log)
DescriptionBrachypodium distachyon miR7730 stem-loop
Stem-loop
   cucgcgc    aaau            ca   uu          -  ag           ca  a   u   -agu    aac  u   a     a    --       - a  a    c    c    c               u      c   u   ag   u  aauuuuuu  a        a            -     --c      ----c   --    au   uccacc  -   uauuuu 
5'        aucc    ggacagaacagc  cgg  gaaaguuaug gg  uuaauggagga  ua uga agg    aauu   gg agu uaaac gucu  gugaaag c ga gagg uuuu gguc gggaauugauuacgg cuaaua gau ggu  auc gg        ua aaccuaga cgaccuauagaa ggggg   gggagu     gga  agug  gag      ac uac      a
          ||||    ||||||||||||  |||  |||||||||| ||  |||||||||||  || ||| |||    ||||   || ||| ||||| ||||  ||||||| | || |||| |||| |||| ||||||||||||||| |||||| ||| |||  ||| ||        || |||||||| |||||||||||| |||||   ||||||     |||  ||||  |||      || |||       
3'        uagg    ccugucuugucg  gcc  cuuucaaugc cc  aauugcuuccu  au acu ucc    uuaa   cc uca auuug caga  uacuuuc g cu cucc aaaa cuag cccuuaacuaauguc gauuau cug cca  uag cc        au uuggaucu gcuggauauuuu cccuu   cccuca     ccu  ucac  cuu      ug aug      c
   -------    gcuu            ac   cu          a  -g           ua  c   u   gauu    -ca  c   c     c    ag       u c  -    a    a    u               u      u   u   cu   c  cauuuuuu  a        a            a     cau      uauua   ag    cu   -ucuuu  u   uucgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 50019627-50020106 [-]
intergenic
Database links

Mature sequence bdi-miR7730-5p

Accession MIMAT0030194
Sequence

20 - 

agaacagccacgguugaaaguuau

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7730-3p

Accession MIMAT0030195
Sequence

447 - 

aacuuucucccgcagcuguucugu

 - 470

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).