Stem-loop sequence bdi-MIR7756

AccessionMI0025376 (change log)
DescriptionBrachypodium distachyon miR7756 stem-loop
Stem-loop
   -       aaa     g         -     u      -   uu  u 
5'  ggcguug   ccaau caaugccaa gucuu cgaugu ugc  ug u
    |||||||   ||||| ||||||||| ||||| |||||| |||  ||  
3'  ccguaac   gguua guuacgguu uagag guuaca aug  ac u
   a       cuc     a         g     -      u   -u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 54324585-54324677 [-]
intergenic
Database links

Mature sequence bdi-miR7756-5p

Accession MIMAT0030256
Sequence

12 - 

caaugcaaugccaagucuuucga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7756-3p

Accession MIMAT0030257
Sequence

60 - 

uggagauguuggcauugaauuggc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).