Stem-loop sequence bdi-MIR7767

AccessionMI0025388 (change log)
DescriptionBrachypodium distachyon miR7767 stem-loop
Stem-loop
   --uuga g  ug  -c       aga    uc -  cga -     gga    -     
5'       u gc  cc  caagcug   gcuc  c ca   c agcuu   cagg aggc 
         | ||  ||  |||||||   ||||  | ||   | |||||   |||| ||| c
3'       g ug  gg  guucgac   cgag  g gu   g ucgag   guuc ucca 
   ccagga g  gu  aa       gaa    ga a  uag c     aag    g     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 9597515-9597625 [-]
intergenic
4: 9834796-9834906 [+]
intergenic
Database links

Mature sequence bdi-miR7767-5p

Accession MIMAT0030282
Sequence

11 - 

ccccaagcugagagcucuccc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7767-3p

Accession MIMAT0030283
Sequence

80 - 

aggagcaagcagcuugaaggu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).