Stem-loop sequence bdi-MIR7772

AccessionMI0025394 (change log)
DescriptionBrachypodium distachyon miR7772 stem-loop
Stem-loop
   ugc  cug ag   c        c        - gcac    g     a 
5'    gu   g  ccg uuuucggu cguggaga c    uccg acgca g
      ||   |  ||| |||||||| |||||||| |    |||| |||||  
3'    ca   c  ggc aagaguca guaccucu g    aggc ugugu u
   -cu  uca ga   a        a        a auuu    -     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 27051633-27051729 [-]
intergenic
Database links

Mature sequence bdi-miR7772-5p

Accession MIMAT0030294
Sequence

13 - 

cgcuuuucgguccguggagacgca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7772-3p

Accession MIMAT0030295
Sequence

64 - 

agaucuccaugaacugagaaacgg

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).