Stem-loop sequence bdi-MIR7774

AccessionMI0025396 (change log)
DescriptionBrachypodium distachyon miR7774 stem-loop
Stem-loop
   --------gu   g  g  aa      ucug   g a g  aa        cug g   -      acu 
5'           agu gu gc  cuaugg    uga g u gc  cuuuaguu   u ugg guggcg   u
             ||| || ||  ||||||    ||| | | ||  ||||||||   | ||| ||||||   u
3'           uca cg ug  ggugcc    auu c a cg  gagaucaa   a acc cgcugc   a
   ugccuugauu   a  g  -g      uuaa   g a g  -a        --a g   g      cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 72902118-72902245 [+]
intergenic
Database links

Mature sequence bdi-miR7774-5p

Accession MIMAT0030298
Sequence

13 - 

acuauggucugugaggauggcaac

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7774-3p

Accession MIMAT0030299
Sequence

87 - 

gagcgaacguuaaauuccgugggg

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).