Stem-loop sequence bdi-MIR7785

AccessionMI0025408 (change log)
DescriptionBrachypodium distachyon miR7785 stem-loop
Stem-loop
   --augauggc   g   aau  g g             cc 
5'           cgu uag   gg u augggagaaggcg  u
             ||| |||   || | |||||||||||||   
3'           gcg guc   cc a ugucuucuuucgu  c
   cguagagaga   a   agu  g g             ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 29739922-29740001 [-]
intergenic
Database links

Mature sequence bdi-miR7785-5p

Accession MIMAT0030326
Sequence

12 - 

guagaaugggugaugggagaaggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7785-3p

Accession MIMAT0030327
Sequence

46 - 

uuucuucugugagccugacugagc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).