Stem-loop sequence ppc-mir-8299

AccessionMI0026987 (change log)
DescriptionPristionchus pacificus miR-8299 stem-loop
Stem-loop
   --              c  a    - auu 
5'   uaguguuuuaguug gu caaa c   c
     |||||||||||||| || |||| |    
3'   aucacgaaauuaau ca guuu g   a
   cc              a  c    u gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 226063-226119 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8299
ppc-mir-2272ABKE03000073.1: 220023-220140 [+]
ppc-mir-8263ABKE03000073.1: 220213-220275 [+]
ppc-mir-2273ABKE03000073.1: 220330-220428 [+]
ppc-mir-8223ABKE03000073.1: 220630-220686 [+]
ppc-mir-2267ABKE03000073.1: 220769-220883 [+]
ppc-mir-8351ABKE03000073.1: 225677-225741 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
ppc-mir-8307ABKE03000073.1: 235868-235928 [-]
Database links

Mature sequence ppc-miR-8299-5p

Accession MIMAT0033115
Sequence

1 - 

uaguguuuuaguugcguacaaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8299-3p

Accession MIMAT0033116
Sequence

36 - 

ugcacauaauuaaagcacuacc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).