Stem-loop sequence ppc-mir-8351

AccessionMI0027059 (change log)
DescriptionPristionchus pacificus miR-8351 stem-loop
Stem-loop
   --ua      u   cca     u  uguu  cu 
5'     cucggc cug   gucuu ca    gc  u
       |||||| |||   ||||| ||    ||   
3'     gagccg gac   cagag gu    ug  u
   cgga      u   -ag     u  uucc  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 225677-225741 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8351
ppc-mir-2272ABKE03000073.1: 220023-220140 [+]
ppc-mir-8263ABKE03000073.1: 220213-220275 [+]
ppc-mir-2273ABKE03000073.1: 220330-220428 [+]
ppc-mir-8223ABKE03000073.1: 220630-220686 [+]
ppc-mir-2267ABKE03000073.1: 220769-220883 [+]
ppc-mir-8351ABKE03000073.1: 225677-225741 [+]
ppc-mir-8299ABKE03000073.1: 226063-226119 [+]
ppc-mir-8348ABKE03000073.1: 226430-226488 [+]
ppc-mir-8282bABKE03000073.1: 226545-226603 [+]
ppc-mir-8282aABKE03000073.1: 226753-226811 [+]
ppc-mir-8282cABKE03000073.1: 227223-227281 [+]
ppc-mir-8358ABKE03000073.1: 227347-227413 [+]
ppc-mir-8320ABKE03000073.1: 227746-227804 [+]
ppc-mir-8274ABKE03000073.1: 234904-234962 [-]
Database links

Mature sequence ppc-miR-8351-5p

Accession MIMAT0033254
Sequence

1 - 

uacucggcucugccagucuuuca

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8351-3p

Accession MIMAT0033255
Sequence

44 - 

ugagacgacagugccgagaggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).