Stem-loop sequence pxy-mir-8494

AccessionMI0027297 (change log)
DescriptionPlutella xylostella miR-8494 stem-loop
Stem-loop
   aau      gc    uc          a  c  g      uuuuaa 
5'    gauaag  aucu  uucucuacug gu ug cagugg      u
      ||||||  ||||  |||||||||| || || ||||||       
3'    uuauuc  uaga  aagagaugac ca ac gucacu      u
   auu      au    ua          c  a  a      uauaau 
Get sequence
Deep sequencing
90 reads, 2.35e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_14: 1548292-1548385 [-]
intergenic
Database links

Mature sequence pxy-miR-8494-5p

Accession MIMAT0033702
Sequence

17 - 

cuucucuacugagucuggcagug

 - 39

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8494-3p

Accession MIMAT0033703
Sequence

58 - 

cugacaaacccaguagagaaau

 - 79

Get sequence
Deep sequencing37 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1