Stem-loop sequence pxy-mir-8496

AccessionMI0027299 (change log)
DescriptionPlutella xylostella miR-8496 stem-loop
Stem-loop
   -      u    a    uu        -  -u   g 
5'  aauuuu guaa gaac  cguguauu cg  uua u
    |||||| |||| ||||  |||||||| ||  |||  
3'  uuaaaa uauu cuug  gcacauaa gu  aau u
   a      u    -    uu        u  uu   a 
Get sequence
Deep sequencing
16 reads, 425 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_15: 249207-249276 [-]
intergenic
Database links

Mature sequence pxy-miR-8496

Accession MIMAT0033706
Sequence

39 - 

auuuguaauacacguuguucuu

 - 60

Get sequence
Deep sequencing16 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1