Stem-loop sequence pxy-mir-8497

AccessionMI0027300 (change log)
DescriptionPlutella xylostella miR-8497 stem-loop
Literature search

1 open access papers mention pxy-mir-8497
(1 sentences)

Stem-loop
   aca     u g aauag   uau   a  g           -----a              c   u              a       g  aaaaaa 
5'    gagug u c     ugg   acu ag cccuguuucac      ugguuaguggcuac ugu agauaaaaugcaug ugucacu uc      a
      ||||| | |     |||   ||| || |||||||||||      |||||||||||||| ||| |||||||||||||| ||||||| ||      u
3'    cucau g g     acc   uga uc gggacaaagug      accaaucaucgaug aca ucuauuuuauguac acaguga ag      u
   uaa     u g -ggaa   ---   a  g           auauag              c   u              g       g  acaaua 
Get sequence
Deep sequencing
126 reads, 3.25e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_244: 76387-76574 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8497
pxy-mir-8517ascaffold_244: 75865-76037 [-]
pxy-mir-8497scaffold_244: 76387-76574 [+]
Database links

Mature sequence pxy-miR-8497

Accession MIMAT0033707
Sequence

63 - 

gauaaaaugcaugaugucacugu

 - 85

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1