Stem-loop sequence pxy-mir-8498

AccessionMI0027301 (change log)
DescriptionPlutella xylostella miR-8498 stem-loop
Stem-loop
   acc    c    g               u   g      uaag 
5'    aagc gaua ucagcuuucgcaauu gcc cacccg    u
      |||| |||| ||||||||||||||| ||| ||||||     
3'    uucg uuau agucgaaagcguuaa cgg gugggu    g
   aua    u    g               -   g      cuau 
Get sequence
Deep sequencing
8 reads, 267 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_7: 1650954-1651040 [+]
intergenic
Database links

Mature sequence pxy-miR-8498

Accession MIMAT0033708
Sequence

53 - 

guggggcaauugcgaaagcug

 - 73

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1