Stem-loop sequence pxy-mir-308

Accession

MI0027315 (change log)

Description

Plutella xylostella miR-308 stem-loop

Literature search

2 open access papers mention pxy-mir-308
(6 sentences)

Stem-loop

   aug           u  a    a   -  u 
5'    cgcaguauuau cc guga ugu gu u
      ||||||||||| || |||| ||| ||  
3'    gcgucauaaua gg cacu aca cg c
   uga           -  a    a   u  a 

Deep sequencing

135 reads, 3.52e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

Coordinates (1.0)	Overlapping transcripts
scaffold_141: 147570-147629 [-]	intergenic
scaffold_52: 420535-420594 [+]	intergenic

Database links

• miRBase Tracker:MI0027315

Mature sequence pxy-miR-308

• Accession: MIMAT0033723
• Sequence: 4 - cgcaguauuauuccagugaaugu - 26
• Deep sequencing: 42 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24236051 "Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)" Liang P, Feng B, Zhou X, Gao X PLoS One. 8:e78787(2013).