Stem-loop sequence pxy-mir-8512-2

AccessionMI0027333 (change log)
DescriptionPlutella xylostella miR-8512-2 stem-loop
Gene family MIPF0002076; mir-8512
Stem-loop
   ccc   caa   c  -            c  --   c 
5'    ggc   uac gg acuaugaaagcc ac  cuc g
      |||   ||| || |||||||||||| ||  |||  
3'    ccg   aug cc ugauacuuuugg ug  gag a
   auc   ucc   a  a            a  ca   c 
Get sequence
Deep sequencing
2 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_197: 338581-338653 [-]
intergenic
Database links

Mature sequence pxy-miR-8512

Accession MIMAT0033737
Sequence

42 - 

cguagguuuucauaguaccagua

 - 64

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1