Stem-loop sequence pxy-mir-929

AccessionMI0027339 (change log)
DescriptionPlutella xylostella miR-929 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   cgc    -      u  g  a         g         -  u  c 
5'    agcc caugga gu aa uugacucua uagggaguc cg gu c
      |||| |||||| || || ||||||||| ||||||||| || ||  
3'    ucgg guaucu ca uu gacugaggu aucccucag gc cg a
   caa    a      u  g  g         a         c  -  c 
Get sequence
Deep sequencing
9 reads, 225 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_775: 26254-26346 [+]
intergenic
Database links

Mature sequence pxy-miR-929

Accession MIMAT0033750
Sequence

56 - 

cucccuaauggagucagguug

 - 76

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1