Stem-loop sequence pxy-mir-279a

AccessionMI0027347 (change log)
DescriptionPlutella xylostella miR-279a stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention pxy-mir-279a
(8 sentences)

Stem-loop
   cua    c      cg          ag      g     uuu 
5'    uaua augcag  agugggugua  ucuagu cacag   u
      |||| ||||||  ||||||||||  |||||| |||||   u
3'    guau uacguu  uuacucacau  agauca guguu   a
   uua    -      ag          cu      -     uua 
Get sequence
Deep sequencing
383 reads, 1e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_1: 609684-609770 [+]
intergenic
Database links

Mature sequence pxy-miR-279a

Accession MIMAT0033755
Sequence

17 - 

aguggguguaagucuagugcaca

 - 39

Get sequence
Deep sequencing18 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1