Stem-loop sequence pxy-mir-8530

AccessionMI0027368 (change log)
DescriptionPlutella xylostella miR-8530 stem-loop
Literature search

1 open access papers mention pxy-mir-8530
(1 sentences)

Stem-loop
   gc    -        c       u               -  u 
5'   uggc gggcggug ggacaga cgugauggccuuaga cu u
     |||| |||||||| ||||||| ||||||||||||||| || c
3'   gccg ccugccau ccuguuu gcacuacuggaaucu ga g
   aa    a        c       u               a  u 
Get sequence
Deep sequencing
40 reads, 1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_98: 774474-774560 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8530
pxy-mir-8520scaffold_98: 782739-782833 [-]
pxy-mir-8530scaffold_98: 774474-774560 [-]
Database links

Mature sequence pxy-miR-8530-5p

Accession MIMAT0033772
Sequence

18 - 

acagaucgugauggccuuaga

 - 38

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8530-3p

Accession MIMAT0033773
Sequence

51 - 

uaaggucaucacguuuugucc

 - 71

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1