Stem-loop sequence pxy-mir-10

AccessionMI0027386 (change log)
DescriptionPlutella xylostella miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention pxy-mir-10
(4 sentences)

Stem-loop
   uagcaucaaauauua    c      cu   -  g    u           ugaa 
5'                gugc cuacau  acc cu uaga ccgaauuuguu    g
                  |||| ||||||  ||| || |||| |||||||||||    u
3'                cacg ggugug  ugg ga aucu ggcuuaaacag    g
   --------------g    u      uu   a  g    u           cgga 
Get sequence
Deep sequencing
1480 reads, 3.84e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_121: 165252-165349 [-]
intergenic
Database links

Mature sequence pxy-miR-10-5p

Accession MIMAT0033793
Sequence

28 - 

uacccuguagauccgaauuugu

 - 49

Get sequence
Deep sequencing451 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-10-3p

Accession MIMAT0033794
Sequence

65 - 

aaauucgguucuagagagguuu

 - 86

Get sequence
Deep sequencing1028 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1