Stem-loop sequence pxy-mir-8510a-6

AccessionMI0027413 (change log)
DescriptionPlutella xylostella miR-8510a-6 stem-loop
Gene family MIPF0001886; mir-8510
Stem-loop
   ug     g     a    g        c  a   -  g 
5'   uucuc ucgau cugu aucucacc gc agu cg u
     ||||| ||||| |||| |||||||| || ||| ||  
3'   gaggg aguua gaua uagagugg cg uca gu c
   ag     a     c    g        a  c   c  g 
Get sequence
Deep sequencing
308 reads, 8.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_211: 758499-758575 [-]
intergenic
scaffold_858: 134-210 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8510a-6
pxy-mir-8510a-6scaffold_211: 758499-758575 [-]
pxy-mir-8510a-5scaffold_211: 758017-758121 [-]
pxy-mir-8510a-1scaffold_211: 757646-757712 [-]
pxy-mir-8510a-4scaffold_211: 757068-757172 [-]
pxy-mir-8510a-7scaffold_211: 756073-756153 [-]
pxy-mir-8510a-8scaffold_211: 755257-755323 [-]
pxy-mir-8510a-2scaffold_211: 754738-754803 [-]
pxy-mir-8510a-2scaffold_211: 754182-754247 [-]
Database links

Mature sequence pxy-miR-8510a-5p

Accession MIMAT0033732
Sequence

14 - 

acugugaucucacccgcaagu

 - 34

Get sequence
Deep sequencing472 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8510a-3p

Accession MIMAT0033733
Sequence

46 - 

ucgcaggugagaugauagcauu

 - 67

Get sequence
Deep sequencing1715 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1