Stem-loop sequence pxy-mir-279b

AccessionMI0027421 (change log)
DescriptionPlutella xylostella miR-279b stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention pxy-mir-279b
(8 sentences)

Stem-loop
   uuu    uc    c          uu      u    uuuug 
5'    cucu  ugga gaugagugaa  uuuagu cacg     a
      ||||  |||| ||||||||||  |||||| ||||      
3'    gagg  aucu cuacucacuu  agauca gugc     c
   agc    gu    c          uu      -    cauaa 
Get sequence
Deep sequencing
131 reads, 3.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_54: 779587-779671 [+]
intergenic
Database links

Mature sequence pxy-miR-279b-5p

Accession MIMAT0033819
Sequence

15 - 

gaugagugaauuuuuaguucacg

 - 37

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-279b-3p

Accession MIMAT0033820
Sequence

52 - 

ugacuagauuuucacucauccu

 - 73

Get sequence
Deep sequencing128 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1