Stem-loop sequence atr-MIR8580

AccessionMI0027465 (change log)
DescriptionAmborella trichopoda miR8580 stem-loop
Stem-loop
                   auau   u              c      u         u    --c     uu     c  uu  a 
5' uggaaaugagguugcg    ucu caccauccauuuua uuggac guguagguu gaau   guuuu  aagac gu  ca u
   ||||||||||||||||    ||| |||||||||||||| |||||| ||||||||| ||||   |||||  ||||| ||  || g
3' aucuuuauuccaacgu    gga gugguagguaagau aaucug cacaucuaa cuug   uagaa  uucug ca  gu g
                   cagu   u              a      u         -    uga     uu     -  cu  a 
Get sequence
Deep sequencing
151 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00003: 1980853-1981017 [-]
intergenic
Database links

Mature sequence atr-miR8580

Accession MIMAT0033864
Sequence

120 - 

ugucuaaauagaauggauggugua

 - 143

Get sequence
Deep sequencing55 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).