Stem-loop sequence atr-MIR8589

AccessionMI0027477 (change log)
DescriptionAmborella trichopoda miR8589 stem-loop
Stem-loop
     cu     guuc    --cc           cuaga a       -   u     aggc    a   a           a u           u 
5' cu  ccucu    acug    gugugcuucau     c aucagac ccu cuacc    gugu ucc uggucgagaaa c ugguccuuaca u
   ||  |||||    ||||    |||||||||||     | ||||||| ||| |||||    |||| ||| ||||||||||| | |||||||||||  
3' ga  gggga    ugac    cacacgaagua     g uaguuug gga ggugg    caca agg accggcuuuuu g accaggaaugu g
     ag     --aa    aaca           ---ag a       a   c     caua    a   c           a c           a 
Get sequence
Deep sequencing
95 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00055: 2362010-2362193 [-]
intergenic
Database links

Mature sequence atr-miR8589

Accession MIMAT0033876
Sequence

100 - 

aggaccacgauuuuucggccacgg

 - 123

Get sequence
Deep sequencing65 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).