Stem-loop sequence atr-MIR164a

AccessionMI0027511 (change log)
DescriptionAmborella trichopoda miR164a stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
     uc          ca         c        u       ccuuugaagaugaagaaaa 
5' gc  gauggagaag  gggcacgug auuacaaa ccaucuu                   a
   ||  ||||||||||  ||||||||| |||||||| |||||||                   g
3' cg  cuaccucuuc  uccguguac ugguguuu gguggga                   a
     ua          ua         u        u       auguaaagugaugaaaaga 
Get sequence
Deep sequencing
3220 reads, 1.11e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 3789229-3789353 [+]
intergenic
Database links

Mature sequence atr-miR164a

Accession MIMAT0033913
Sequence

7 - 

uggagaagcagggcacgugca

 - 27

Get sequence
Deep sequencing2481 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).