Stem-loop sequence atr-MIR164b

AccessionMI0027512 (change log)
DescriptionAmborella trichopoda miR164b stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
      -   u ca    cccgugc     gau      c           ca             ---c   c 
5' ggu gag g  agag       gggug   gaaccc uguuggagaag  gggcacgugcaaa    aca g
   ||| ||| |  ||||       |||||   |||||| |||||||||||  |||||||||||||    ||| u
3' uca cuc c  ucuc       uccac   uuuggg acaaccucuuc  cucgugcacguuu    ugu g
      u   u uc    -------     -ac      u           cc             cucc   c 
Get sequence
Deep sequencing
2544 reads, 1.05e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00045: 3520956-3521088 [-]
intergenic
Database links

Mature sequence atr-miR164b

Accession MIMAT0033914
Sequence

40 - 

uggagaagcagggcacgugca

 - 60

Get sequence
Deep sequencing2479 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).