Stem-loop sequence atr-MIR166a

AccessionMI0027513 (change log)
DescriptionAmborella trichopoda miR166a stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
        -     a        uu             -  a     --c   ua 
5' cuugg gguug ggggaaug  gucugguucgaaa cc uuuug   gau  u
   ||||| ||||| ||||||||  ||||||||||||| || |||||   |||  a
3' gaacu ccaac ccccuuac  cggaccaggcuuu gg aaagc   cua  u
        u     c        uu             a  -     uau   cc 
Get sequence
Deep sequencing
530368 reads, 1.45e+05 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00002: 8188982-8189083 [+]
intergenic
Database links

Mature sequence atr-miR166a

Accession MIMAT0033915
Sequence

70 - 

ucggaccaggcuucauucccc

 - 90

Get sequence
Deep sequencing530019 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).