Stem-loop sequence atr-MIR168

AccessionMI0027518 (change log)
DescriptionAmborella trichopoda miR168 stem-loop
Gene family MIPF0000081; MIR168
Stem-loop
   uca   g  a   -au    u          agagaaaca      a  aa   uu    u  --u    -    cuua      c   c          u          uc  acuuuaau 
5'    aga cu ucc   ggau gaggguccag         ugcaau ca  agu  gggc uc   ucuu acug    cucuag ucg uuggugcagg cgggaacccu  gc        a
      ||| || |||   |||| ||||||||||         |||||| ||  |||  |||| ||   |||| ||||    |||||| ||| |||||||||| ||||||||||  ||         
3'    ucu ga agg   ucua uuuuuagguc         acguua gu  uca  uuug ag   agaa ugac    gagguu agu aacuacguuc gcccuuggga  cg        c
   -ag   g  c   cgu    -          ---------      -  -a   -u    u  cuu    a    auca      a   c          c          ga  aucacucc 
Get sequence
Deep sequencing
20340 reads, 7.97e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00011: 8252667-8252896 [+]
intergenic
Database links

Mature sequence atr-miR168

Accession MIMAT0033920
Sequence

83 - 

ucgcuuggugcaggucgggaa

 - 103

Get sequence
Deep sequencing19040 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).